EIGHT-CLUSTER STRUCTURE OF CHLOROPLAST GENOMES DIFFERS FROM SIMILAR ONE OBSERVED FOR BACTERIA

Abstract

Previously, a seven-cluster pattern claiming to be a universal one in bacterial genomes has been reported. Keeping in mind the most popular theory of chloroplast origin, we checked whether a similar pattern is observed in chloroplast genomes. Surprisingly, eight cluster structure has been found, for chloroplasts. The pattern observed for chloroplasts differs rather significantly, from bacterial one, and from that latter observed for cyanobacteria. The structure is provided by clustering of the fragments of equal length isolated within a genome so that each fragment is converted in triplet frequency dictionary with non-overlapping triplets with no gaps in frame tiling. The points in 63-dimensional space were clustered due to elastic map technique. The eight cluster found in chloroplasts comprises the fragments of a genome bearing tRNA genes and exhibiting excessively high $\mathsf{GC}$-content, in comparison to the entire genome.

I Introduction

Detailed study of a structure of nucleotide sequences is a key issue in up-to-date molecular biology and bioinformatics. Such studies are carried out in two (interconnecting) paradigms: the former is structure-function relationship, and the latter is evolutionary one. A retrieval of the interrelation between structure and function of various biological macromoleculae is a core issue of up-to-date molecular and system biology. Currently, a huge number of publications appears annually on this subject; yet, the problem is still far from any completion. Moreover, some new structures are reported nowadays molevol94 ; plos1-1 .

Evolutionary value of such studies is rather apparent: comparing various structures found in DNA sequences of various organisms, one expects to retrieve the evolution process details ranging from races and species to global ecological systems. Meanwhile, such studies face a number of problems in selection and quality of biological material to be considered. Skipping off possible errors in sequencing and/or annotation of genetic entities, one faces a great complexity of genomes, or even separate chromosomes. Here one has to study a three-sided entity: structure, function, and phylogeny. Quite often all three issues are so tightly interweaved that one fails to distinguish the effects and contributions of each issue separately.

Prokaryotic organisms seem to be rather suitable for this type of researches: bacterial genome is considerably short and always consists of a single chromosome. An ambiguity in bacterial taxonomy looks like a pay-off for the genome simplicity of these organisms; the problem in taxonomy grows up, as higher taxa are considered chunrainy ; bactsex . In such capacity, organella genomes seem to be very suitable object for the studies of the type mentioned above: keeping oneself within the organella of the same type (say, chloroplasts), one avoids any problems related to a diversity of functional charge of a genome.

Here we explore the relation between structure and taxonomy of the bearers of chloroplast genomes. A number of papers aims to study evolutionary processes on the basis of genome sequences structures peculiarities retrieval review12 ; phylo34 or a comparative study of some peculiar fragments of genomes curgen96 ; poljaki ; molevol94 ; plos1-1 ; amjb2006 ; amjb2005 of chloroplasts.

Sounding diversity of structures that could be found in DNA sequences is another problem. Surely, the problem hardness depends on the notion of a structure in DNA molecule. Hereafter a structure is stipulated to be a pattern in mutual interlocation of nucleotides manifesting in statistical properties of formally identified short fragments of a genome, i. e. the ensemble of strings of the given length $q$. Further we shall concentrate on the ensembles of strings of the length $q=3$ (triplets). Henceforth, the list of triplets observed within a genome or its part accompanied with the frequencies of these former is the structure under consideration; see details below.

Indeed, we shall concentrate on the study of mutual location of the points of 63-dimensional space of triplet frequencies, where each point corresponds to a fragment identified within a genome, due to some regular procedure. The matter of interest is a cluster structuredness (if any) of those fragments of genomes converted into frequency dictionaries of triplets, in 63-dimensional metric space. Such approach has been originally explored by Alexander Gorban and co-authors gorban1 ; gorban2 , for bacterial genomes. They have found seven-cluster patterns in the fragments distribution, where the specific type of the pattern is strongly ruled by $\mathsf{GC}$-content of a genome.

The most popular theory of chloroplast origin, that is bacterial symbiogenesis theory merezh ; merezh1 ; cavalier-smith ; chlororigin ; ravenallen ; curopin2014 , stipulates a relation between some bacteria, and chloroplasts; that is the motivation standing behind our study: whether this relation manifests in a similarity of the patterns observed for bacteria gorban1 ; gorban2 , and those observed for chloroplasts. Briefly speaking, the answer is negative. Moreover, chloroplast genomes exhibit rather specific patterns drastically differing them from bacterial genomes, and further we shall present the result demonstrating the difference, and discuss this point.

II Materials and methods

Chloroplast genomes were retrieved from EMBL–bank; the list of entities comprises 178 entries. Table LABEL:genomy enlists the genomes under consideration. Evidently, genomes differ in the quality of sequencing: they may have extra symbols other than $\aleph=\{\mathsf{A},\mathsf{C},\mathsf{G},\mathsf{T}\}$. Wherever it happened, we eliminated such extra symbols from a sequence, and concatenated it into the coherent one.

II.1 Frequency dictionaries and genome fragmentation

We stipulate a genome to be a coherent sequence from four-letter alphabet $\aleph=\{\mathsf{A},\mathsf{C},\mathsf{G},\mathsf{T}\}$; the number $N$ of nucleotides is the length of the sequence. Let then fix the length $q$ of a window, and the length $t$ of a step. Moving then the window upright (for certainty) alongside the sequence with the step $t$ and counting the number $n_{\omega}$ of strings $\omega$ of the given length $q$ identified by the sequential locations of the window, one gets the finite dictionary $\mathsf{F}_{(q,t)}$. Changing the numbers $n_{\omega}$ for frequencies

$$f_{\omega}=\dfrac{n_{\omega}}{M}\qquad\textrm{with}\qquad M=\sum_{\omega}n_{\omega}\,,$$ (1)

one gets the frequency dictionary $W_{(q,t)}$; $M=N$ for $W_{(q,1)}$. Actually, such definition of $W_{(q,t)}$ requires to connect the sequence under consideration into a ring (see details in gorban1 ; gorban2 ; nasha2 ).

Everywhere further we shall constrain with the dictionaries $W_{(3,3)}$, only. It enlists the triplets counted with no overlapping, while with no gaps between the frames. The choice of $q=3$ and $t=3$ is motivated by apparent biological issues: triplets yield the strongest signal, in DNA sequences, and the step $t=3$ reveals it, that is coding positions in DNA sequence.

The frequency dictionary $W_{(3,3)}$ exists in three different (in general) versions differing in reading frame position; that latter is called phase of a fragment below. Indeed, for the sequence

$$\mathsf{CTTGTGCGATCAATTGTTGATCCAGTTTTATGATTGCACCGCAGAAAGTG}$$ (2)

the dictionaries $W_{(3,3)}$: $W^{(0)}_{(3,3)}$, $W^{(1)}_{(3,3)}$ and $W^{(2)}_{(3,3)}$ are shown in Table 1. Here the number of copies, not the frequencies are shown.

Table 1: The dictionaries $W^{(0)}_{(3,3)}$, $W^{(1)}_{(3,3)}$ and $W^{(2)}_{(3,3)}$ for the sequence (2).

$W^{(0)}_{(3,3)}$						$W^{(1)}_{(3,3)}$
$\mathsf{AAG}$	1	$\mathsf{CGA}$	1	$\mathsf{GTT}$	2	$\mathsf{ACC}$	1	$\mathsf{GAA}$	1	$\mathsf{TTG}$	3
$\mathsf{AGA}$	1	$\mathsf{CGC}$	1	$\mathsf{TCA}$	1	$\mathsf{AGT}$	1	$\mathsf{GAT}$	2	$\mathsf{TTT}$	1
$\mathsf{ATT}$	1	$\mathsf{CTT}$	1	$\mathsf{TGA}$	1	$\mathsf{ATC}$	1	$\mathsf{GCA}$	1
$\mathsf{CAC}$	1	$\mathsf{GAT}$	1	$\mathsf{TTA}$	1	$\mathsf{CAA}$	1	$\mathsf{TAT}$	1
$\mathsf{CCA}$	1	$\mathsf{GTG}$	1	$\mathsf{TTG}$	1	$\mathsf{CAG}$	1	$\mathsf{TGC}$	2
$W^{(2)}_{(3,3)}$
$\mathsf{AAA}$	1	$\mathsf{ATT}$	1	$\mathsf{GTG}$	1
$\mathsf{AAT}$	1	$\mathsf{CAG}$	1	$\mathsf{TCC}$	1
$\mathsf{AGT}$	1	$\mathsf{CCG}$	1	$\mathsf{TGA}$	1
$\mathsf{ATC}$	1	$\mathsf{GCA}$	1	$\mathsf{TGT}$	2
$\mathsf{ATG}$	1	$\mathsf{GCG}$	1	$\mathsf{TTT}$	1

Everywhere below, we shall develop the frequency dictionaries $W^{(0)}_{(3,3)}$ for each fragment of a sequence. Reciprocally, the phase of the fragment has been determined, instead of the implementation of two other dictionaries; see details below.

To figure out the inner structuredness of a chloroplast genome, we cut it into a set of (overlapping) fragments. To do that, the length of a fragment $L$ and the move step $R$ alongside a genomes have been fixed; we used the figures $L=603$ and $R=11$, in our studies. The motivation for the choice of such figures is following: we need to choose the length $L$ of a fragment to be odd and divisible by 3, while the step $R$ must be not divisible by 3. Next, the length of a fragment is chosen rather close to a gene length. The step length $R$ determines the number of points taken into consideration, e. g. for $K$-means clustering; the chosen step figure yields $\sim 10^{4}$ fragments (later converted into the points in a metric space). Obviously, both $L$ and $R$ could be set de novo, if necessary.

Any frequency dictionary $W_{(3,\cdot)}$ maps a sequence into a point in 63-dimensional space. Indeed, the total number of triplets is equal to 64; meanwhile, the linear constraint

$$\sum_{\omega=\mathsf{AAA}}^{\mathsf{TTT}}f_{\omega}=1$$ (3)

makes remain only 63 ones independent; the frequency of the last one is unambiguously determined from (3). Formally, any triplet may be eliminated; practically, we excluded the triplet exhibiting the least standard deviation figure determined over the entire ensemble of the fragments. Table LABEL:genomy shows these triplets, at the column labeled $\omega_{\min}$.

Apparently, there might be other ways to determine the excluded triplet. For example, it is useful to exclude the variable with maximum value, for some situations; here we followed the described above way, since the least standard deviation of a triplet frequencies observed over a dataset means the least distinguishability of the objects comprising a dataset, over this variable. Thus, the dimensionality of the space to cluster the frequency dictionaries of triplets becomes equal to 63.

II.1.1 The phase of a fragment of sequence

Previously, three types of frequency dictionaries $W^{(0)}_{(3,3)}$, $W^{(1)}_{(3,3)}$ and $W^{(2)}_{(3,3)}$ were shown (see Table 1). Meanwhile, we developed only one frequency dictionary; that was $W^{(0)}_{(3,3)}$ dictionary. The fragment was then labeled using one of four labels: phase 1, phase 2, phase 3 and junk. The label was determined by the location of a fragment within a sequence; to do that, we used the annotation of each genome under consideration.

A fragment was labeled as

junk,

if it contains at least a half of a non-coding region of a genome within itself;

phase 0,

if the center of a fragment falls into a coding region of a genome, and the reminder of the division of the distance between the central nucleotide of a fragment, and the starting nucleotide of a coding region is equal to 0;

phase 1,

if the center of a fragment falls into a coding region of a genome, and the reminder of the division of the distance between the central nucleotide of a fragment, and the starting nucleotide of a coding region is equal to 1;

phase 2,

if the center of a fragment falls into a coding region of a genome, and the reminder of the division of the distance between the central nucleotide of a fragment, and the starting nucleotide of a coding region is equal to 2.

For genes (or coding regions) located in the ladder strand, the above mentioned procedure still holds true, but the distance to the central nucleotide of a fragment is determined not from the start position (formally indicated in a file), but from the end of that latter.

II.2 Clustering of frequency dictionaries

As soon, as the fragments are converted into the frequency dictionaries $W^{(0)}_{(3,3)}$, then each dictionary was labeled with the number of the nucleotide occupying the central position at the corresponding fragment. Also, each fragment was labeled with its phase. To make the space of frequency dictionaries metric, one must implement a metrics; there is a number of options here (see c3 ; obzor1 ; n3_3 ; n4 ; gorbanzyn2 ; gorbanzyn ; gorbanzyn1 ; gorbanzyn3 for details). Meanwhile, we use Euclidean metrics:

$$\rho\left(W^{[1]}_{(3,3)},W^{[2]}_{(3,3)}\right)=\sqrt{\sum_{\omega=\mathsf{AAA}}^{\mathsf{TTT}}\left(f^{[1]}_{\omega}-f^{[2]}_{\omega}\right)^{2}}\,.$$ (4)

Here $f^{[j]}_{\omega}$ is the frequency of a triplet $\omega$ observed in the $j^{\textrm{th}}$ frequency dictionary; this index has nothing to do with the frame shift described above.

We studied the distribution of those fragments, in 63-dimensional space using VidaExpert (http://bioinfo-out.curie.fr/projects/vidaexpert/) software. No special technique for clustering has been used: we identified the clusters as is, through visualization. Nonetheless, all the clusters identified through visualization were also identified with $K$-means; thus, those clusters could be verified objectively.

In addition, $\mathsf{GC}$-content has been determined, both for each fragment, and the genome entirely (see Table LABEL:genomy, $\mathsf{GC}$ labeled column).

III Results

First, let’s consider the list of chloroplast genomes used in the study, in more detail. The list is quite homogeneous, in terms of the length of sequences; thus, we may not expect any effect resulted from a length difference. Next point is the eliminated triplet choice; Table LABEL:genomy shows those triplets at the sixth column. Actually, there are only four triplets eliminated in various genomes: $\mathsf{CGC}$ (58 entries), $\mathsf{GCG}$ (113 entries), $\mathsf{GAC}$ (1 entry) and $\mathsf{TAA}$ (also 1 entry).

The triplets $\mathsf{CGC}$ and $\mathsf{GCG}$ are of great interest: they both are palindromes (read equally in opposite directions), and besides they together comprise the couple of so called complementary palindrome. That latter consists of two string (triplets, in our case) that are read equally in opposite directions, with respect to Chargaff’s parity rule: $\mathsf{CGC}\Leftrightarrow\mathsf{GCG}$. Such symmetry is rather important both in analysis, and in biological issues standing behind it; more detailed discussion see below.

Table 2: List of genomes studied; $N$ is the length of genome, $\mathsf{GC}$ is $\mathsf{GC}$-content, $J$ is junk percentage, and $\omega_{\min}$ is the triplet with minimal standard deviation

Genomes	AC number	$N$	$\mathsf{GC}$	$J$	$\omega_{\min}$	$\Updownarrow$
Allium cepa (onion)	KF728080	153538	0.37	41.84	CGC	$\mathsf{U}$
Aneura mirabilis	EU043314	108007	0.41	56.11	GCG	$\mathsf{U}$
Angiopteris evecta	DQ821119	153901	0.35	54.15	GCG	$\mathsf{U}$
Anthoceros angustus	AB086179	161162	0.33	48.48	GCG	$\mathsf{D}$
Apopellia endiviifolia	JX827163	120544	0.36	38.62	CGC	$\mathsf{U}$
Arabidopsis thaliana	AP000423	154478	0.36	48.76	CGC	$\mathsf{U}$
Brachypodium distachyon	EU325680	135197	0.39	59.56	GCG	$\mathsf{D}$
Cycas revoluta	JN867588	162489	0.39	45.93	CGC	$\mathsf{D}$
Equisetum arvense	GU191334	133309	0.33	45.07	GCG	$\mathsf{U}$
Fagopyrum esculentum	EU254477	159596	0.38	47.91	GCG	$\mathsf{U}$
Fargesia nitida	JX513416	139535	0.39	57.45	GCG	$\mathsf{D}$
Fragaria chiloensis	JN884816	155603	0.37	48.83	GCG	$\mathsf{U}$
Fritillaria hupehensis	KF712486	152145	0.37	52.61	GCG	$\mathsf{U}$
Gaoligongshania megalothyrsa	JX513419	140064	0.39	57.58	GCG	$\mathsf{U}$
Genlisea margaretae	HG530134	141252	0.38	58.61	GCG	$\mathsf{U}$
Ginkgo biloba	AB684440	156945	0.40	53.00	GCG	$\mathsf{U}$
Glycine max	DQ317523	152218	0.35	48.49	CGC	$\mathsf{U}$
Glycyrrhiza glabra	KF201590	127942	0.34	47.78	CGC	$\mathsf{D}$
Gnetum montanum	KC427271	115019	0.38	46.70	CGC	$\mathsf{U}$
Goodyera fumata	KJ501999	155643	0.37	48.37	CGC	$\mathsf{U}$
Gossypium anomalum	JF317351	159505	0.37	50.02	GCG	$\mathsf{U}$
Guizotia abyssinica	EU549769	151762	0.38	48.47	CGC	$\mathsf{D}$
Habenaria pantlingiana	KJ524104	153951	0.37	48.25	GCG	$\mathsf{U}$
Helianthus annuus	DQ383815	151104	0.38	48.55	GCG	$\mathsf{U}$
Hibiscus syriacus	KP688069	161019	0.37	60.43	GCG	$\mathsf{U}$
Hordeum vulgare	KC912688	114434	0.37	50.92	CGC	$\mathsf{D}$
Huperzia lucidula	AY660566	154373	0.36	52.05	CGC	$\mathsf{U}$
Hyoscyamus niger	KF248009	155720	0.38	48.91	CGC	$\mathsf{U}$
Hypseocharis bilobata	KF240616	165002	0.39	49.61	CGC	$\mathsf{U}$
Illicium oligandrum	EF380354	148553	0.39	52.06	GCG	$\mathsf{U}$
Indosasa sinica	JX513422	139660	0.39	57.70	CGC	$\mathsf{U}$
Iochroma nitidum	KP294386	156574	0.38	50.61	CGC	$\mathsf{U}$
Ipomoea batatas	KP212149	161303	0.38	53.18	GCG	$\mathsf{U}$
Jacobaea vulgaris	HQ234669	150688	0.37	49.17	GCG	$\mathsf{U}$
Jasminum nudiflorum	DQ673255	165121	0.38	49.87	GCG	$\mathsf{U}$
Jatropha curcas	FJ695500	163856	0.35	51.33	GCG	$\mathsf{U}$
Juniperus bermudiana	KF866297	127631	0.35	40.85	CGC	$\mathsf{U}$
Juniperus monosperma	KF866298	127744	0.35	40.75	CGC	$\mathsf{U}$
Juniperus virginiana	KF866300	127770	0.35	40.92	CGC	$\mathsf{U}$
Kalopanax septemlobus	KC456167	156413	0.38	50.68	GCG	$\mathsf{U}$
Keteleeria davidiana	AP010820	117720	0.39	45.19	CGC	$\mathsf{U}$
Lactuca sativa	AP007232	152765	0.38	52.30	GCG	$\mathsf{U}$
Larix decidua	AB501189	122474	0.39	49.58	CGC	$\mathsf{U}$
Lathyrus sativus	HM029371	121020	0.35	44.25	GCG	$\mathsf{U}$
Lecomtella madagascariensis	HF543599	139073	0.39	57.13	GCG	$\mathsf{U}$
Lemna minor	DQ400350	165955	0.36	49.42	GCG	$\mathsf{U}$
Lepidium virginicum	AP009374	154743	0.36	48.68	GCG	$\mathsf{U}$
Licania alba	KJ414483	162467	0.36	51.53	GCG	$\mathsf{U}$
Lindenbergia philippensis	HG530133	155103	0.38	48.93	GCG	$\mathsf{U}$
Liquidambar formosana	KC588388	160410	0.38	50.85	GCG	$\mathsf{U}$
Liriodendron tulipifera	DQ899947	159886	0.39	50.29	GCG	$\mathsf{U}$
Lobularia maritima	AP009375	152659	0.37	48.37	GCG	$\mathsf{U}$
Lolium perenne	AM777385	135282	0.38	55.66	GCG	$\mathsf{U}$
Lonicera japonica	KJ170923	155078	0.39	51.72	CGC	$\mathsf{U}$
Lotus japonicus	AP002983	150519	0.36	48.85	CGC	$\mathsf{U}$
Lupinus luteus	KC695666	151891	0.37	48.73	GCG	$\mathsf{U}$
Lygodium japonicum	KC536645	157260	0.41	48.69	CGC	$\mathsf{U}$
Magnolia kwangsiensis	HM775382	159667	0.39	50.92	GCG	$\mathsf{U}$
Manihot esculenta	EU117376	161453	0.36	55.23	GCG	$\mathsf{U}$
Mankyua chejuensis	JF343520	146221	0.38	52.36	CGC	$\mathsf{U}$
Marchantia paleacea	X04465	121024	0.29	39.93	GCG	$\mathsf{D}$
Marsilea crenata	KC536646	151628	0.42	47.23	GCG	$\mathsf{U}$
Masdevallia coccinea	KP205432	157423	0.37	49.71	GCG	$\mathsf{U}$
Megaleranthis saniculifolia	FJ597983;	159924	0.38	50.77	GCG	$\mathsf{U}$
Metapanax delavayi	KC456165	156343	0.38	50.65	GCG	$\mathsf{U}$
Millettia pinnata	JN673818	152968	0.35	49.03	CGC	$\mathsf{U}$
Morus indica	DQ226511	158484	0.36	50.05	GCG	$\mathsf{U}$
Myriopteris lindheimeri	HM778032	155770	0.43	48.17	GCG	$\mathsf{U}$
Nageia nagi	AB830885	133722	0.37	44.15	GCG	$\mathsf{D}$
Najas flexilis	JX978472	156362	0.38	58.16	GCG	$\mathsf{D}$
Nasturtium officinale	AP009376	155105	0.36	49.00	CGC	$\mathsf{U}$
Nelumbo lutea	FJ754269	163206	0.38	51.25	GCG	$\mathsf{U}$
Neyraudia reynaudiana	KF356392	135367	0.38	55.66	CGC	$\mathsf{U}$
Nicotiana sylvestris	AB237912	155941	0.38	46.15	CGC	$\mathsf{U}$
Nuphar advena	DQ354691	160866	0.39	50.64	GCG	$\mathsf{U}$
Nymphaea alba	AJ627251	159930	0.39	49.50	GCG	$\mathsf{U}$
Oenothera argillicola	EU262887	165061	0.39	50.34	CGC	$\mathsf{U}$
Olea europaea	GU228899	155888	0.38	49.06	GCG	$\mathsf{U}$
Oligostachyum shiuyingianum	JX513423	139647	0.39	57.64	CGC	$\mathsf{U}$
Olimarabidopsis pumila	AP009368	154737	0.36	49.16	GCG	$\mathsf{U}$
Ophioglossum californicum	KC117178	138270	0.42	47.57	CGC	$\mathsf{U}$
Orobanche gracilis	HG803179	65533	0.35	73.30	GCG	$\mathsf{U}$
Orthotrichum rogeri	KP119739	123363	0.28	43.01	CGC	$\mathsf{D}$
Oryza nivara	AP006728	134494	0.39	50.23	CGC	$\mathsf{D}$
Oryza sativa	JN861109	134448	0.39	54.61	CGC	$\mathsf{D}$
Oryza sativa	JN861110	134459	0.39	55.21	CGC	$\mathsf{D}$
Oryza sativa Indica	AY522329	134496	0.39	63.88	CGC	$\mathsf{D}$
Oryza sativa Japonica	AY522330	134551	0.39	66.96	GCG	$\mathsf{D}$
Oryza sativa Japonica	GU592207	134551	0.39	64.36	GCG	$\mathsf{D}$
Oryza sativa Japonica	X15901	134525	0.39	42.96	CGC	$\mathsf{D}$
Pachycladon cheesemanii	JQ806762	154498	0.36	49.20	GCG	$\mathsf{U}$
Paeonia obovata	KJ206533	152696	0.38	49.68	GCG	$\mathsf{U}$
Panax ginseng	AY582139	156313	0.38	49.32	GCG	$\mathsf{U}$
Panicum virgatum	HQ731441	139677	0.39	57.05	GCG	$\mathsf{U}$
Paphiopedilum armeniacum	KJ566307	162682	0.35	55.30	CGC	$\mathsf{D}$
Parinari campestris	KJ414486	162637	0.36	51.58	GCG	$\mathsf{U}$
Parthenium argentatum	GU120098	152803	0.38	77.21	CGC	$\mathsf{D}$
Pelargonium $\times$ hortorum	DQ897681	217942	0.40	48.14	GCG	$\mathsf{D}$
Pentactina rupicola	JQ041763	156612	0.37	49.40	GCG	$\mathsf{U}$
Penthorum chinense	JX436155	156686	0.37	51.26	GCG	$\mathsf{U}$
Phalaenopsis equestris	JF719062	148959	0.37	56.71	GCG	$\mathsf{U}$
Pharus lappulaceus	KC311467	141928	0.38	58.51	CGC	$\mathsf{U}$
Phoenix dactylifera	GU811709	158462	0.37	50.00	GCG	$\mathsf{U}$
Phragmites australis	KF730315	137561	0.39	56.39	CGC	$\mathsf{U}$
Phyllostachys edulis	HQ337796	139679	0.39	57.14	GCG	$\mathsf{D}$
Phyllostachys propinqua	JN415113	139704	0.39	57.54	GCG	$\mathsf{D}$
Physcomitrella patens	AP005672	122890	0.29	42.08	CGC	$\mathsf{U}$
Picea abies	HF937082	124084	0.39	51.11	CGC	$\mathsf{U}$
Pinguicula ehlersiae	HG803178	147140	0.38	56.14	GCG	$\mathsf{U}$
Pinus contorta	EU998740	115267	0.38	49.93	CGC	$\mathsf{U}$
Pinus taeda (loblolly pine)	KC427273	121530	0.39	44.26	CGC	$\mathsf{D}$
Piper cenocladum	DQ887677	160624	0.38	52.93	GCG	$\mathsf{U}$
Pisum sativum	HM029370	122169	0.35	46.08	GCG	$\mathsf{U}$
Pleioblastus maculatus	JX513424	139720	0.39	57.73	GCG	$\mathsf{D}$
Podocarpus lambertii	KJ010812	133734	0.37	44.25	GCG	$\mathsf{D}$
Populus alba	AP008956	156505	0.37	49.21	GCG	$\mathsf{U}$
Premna microphylla	KM981744	155293	0.38	48.79	GCG	$\mathsf{U}$
Primula poissonii	KF753634	151663	0.37	47.61	CGC	$\mathsf{U}$
Prunus kansuensis	KF990036	157736	0.37	49.51	GCG	$\mathsf{U}$
Pseudotsuga sinensis	AB601120	122513	0.39	50.16	CGC	$\mathsf{D}$
Psilotum nudum	AP004638	138829	0.36	44.90	GCG	$\mathsf{U}$
Pteridium aquilinum	HM535629	152362	0.42	46.95	CGC	$\mathsf{U}$
Ptilidium pulcherrimum	HM222519	119003	0.33	50.36	CGC	$\mathsf{D}$
Puelia olyriformis	KC534841	140318	0.39	57.50	CGC	$\mathsf{U}$
Quercus aliena	KP301144	160921	0.37	51.40	GCG	$\mathsf{U}$
Ranunculus macranthus	DQ359689	155129	0.38	49.02	GCG	$\mathsf{U}$
Raphanus sativus	KJ716483	153368	0.36	47.90	GCG	$\mathsf{U}$
Retrophyllum piresii	KJ617081	133291	0.37	43.87	CGC	$\mathsf{D}$
Rhazya stricta	KJ123753	154736	0.38	49.56	GCG	$\mathsf{U}$
Rosa odorata var. gigantea	KF753637	156634	0.37	49.51	GCG	$\mathsf{U}$
Saccharum hybrid	AP006714	141182	0.38	52.13	GCG	$\mathsf{U}$
Salix interior	KJ742926	156488	0.37	50.78	GCG	$\mathsf{U}$
Salvia miltiorrhiza	HF586694	151332	0.38	46.85	GCG	$\mathsf{U}$
Sanionia uncinata	KM111545	124374	0.29	43.25	CGC	$\mathsf{D}$
Sarocalamus faberi	JX513414	139629	0.39	57.13	GCG	$\mathsf{D}$
Schefflera delavayi	KC456166	156340	0.38	52.95	GCG	$\mathsf{U}$
Schwalbea americana	HG738866	160908	0.38	51.23	GCG	$\mathsf{U}$
Sedum sarmentosum	JX427551	150447	0.38	47.96	CGC	$\mathsf{U}$
Selaginella moellendorffii	HM173080	143775	0.51	50.84	GAC	$\mathsf{D}$
Selaginella uncinata	AB197035	144170	0.55	51.75	TAA	$\mathsf{D}$
Sesamum indicum	JN637766	153324	0.38	48.61	GCG	$\mathsf{U}$
Setaria italica	KJ001642	138833	0.39	56.32	GCG	$\mathsf{U}$
Silene chalcedonica	KF527886	148081	0.36	48.80	GCG	$\mathsf{U}$
Sorghum bicolor	EF115542	140754	0.38	57.71	GCG	$\mathsf{U}$
Spirodela polyrhiza	JN160603	168788	0.36	50.21	GCG	$\mathsf{U}$
Stangeria eriopus	JX416858	163548	0.40	53.62	CGC	$\mathsf{U}$
Stockwellia quadrifida	KC180807	159561	0.37	50.36	GCG	$\mathsf{U}$
Syntrichia ruralis	FJ546412	122501	0.28	45.76	CGC	$\mathsf{D}$
Taxus mairei	KJ123824	129521	0.35	43.14	CGC	$\mathsf{U}$
Tetracentron sinense	KC608752	164467	0.38	49.29	GCG	$\mathsf{U}$
Thamnocalamus spathiflorus	JX513425	139778	0.39	57.47	CGC	$\mathsf{D}$
Trachelium caeruleum	EU090187	162314	0.38	55.90	CGC	$\mathsf{U}$
Trifolium subterraneum	EU849487	144763	0.34	55.12	GCG	$\mathsf{U}$
Trigonobalanus doichangensis	KF990556	159938	0.37	54.96	GCG	$\mathsf{U}$
Triticum aestivum	KC912694	114984	0.37	51.40	CGC	$\mathsf{D}$
Triticum aestivum	KJ592713	133873	0.38	55.70	GCG	$\mathsf{D}$
Triticum aestivum	AB042240	134545	0.38	55.23	GCG	$\mathsf{U}$
Trochodendron aralioides	KC608753	165936	0.38	50.46	GCG	$\mathsf{U}$
Typha latifolia	GU195652	161572	0.37	51.12	GCG	$\mathsf{U}$
Utricularia gibba	KC997777	152044	0.38	49.75	GCG	$\mathsf{U}$
Vaccinium macrocarpon	JQ248601	176037	0.37	72.42	GCG	$\mathsf{U}$
Veratrum patulum	KF437397	153699	0.38	49.23	GCG	$\mathsf{U}$
Vigna radiata	GQ893027	151271	0.35	48.88	CGC	$\mathsf{U}$
Vitis rotundifolia	KF976463	160891	0.37	51.24	GCG	$\mathsf{U}$
Vitis vinifera	AB856289	160927	0.37	51.20	GCG	$\mathsf{U}$
Vitis vinifera	AB856290	160927	0.37	51.18	GCG	$\mathsf{U}$
Vitis vinifera	AB856291	160906	0.37	51.21	GCG	$\mathsf{U}$
Vitis vinifera	DQ424856	160928	0.37	50.93	GCG	$\mathsf{U}$
Viviania marifolia	KF240615	157291	0.38	59.61	GCG	$\mathsf{U}$
Welwitschia mirabilis	EU342371	119726	0.37	44.02	GCG	$\mathsf{U}$
Wolffia australiana	JN160605	168704	0.36	43.94	GCG	$\mathsf{U}$
Yushania levigata	JX513426	139633	0.39	57.41	GCG	$\mathsf{D}$
Zamia furfuracea	JX416857	164953	0.40	50.63	GCG	$\mathsf{U}$
Zea mays	KF241981	140447	0.38	57.32	GCG	$\mathsf{D}$
Zea mays	X86563	140384	0.38	43.85	GCG	$\mathsf{D}$
Zea mays	KF241980	140437	0.38	57.34	GCG	$\mathsf{U}$

III.1 Eight cluster structure of chloroplast genomes

Let now consider the patterns of chloroplast genomes. To do that, we just located the points corresponding to frequency dictionaries of the fragments of a chloroplast genome, in 63-dimensional space. Of course, there is no way to see this distribution immediately. We used ViDaExpert software vida to visualize it. The best way to see a pattern provided by distribution of the fragments converted into frequency dictionaries is to see it in the space determined by three main principal components fukunaga .

To begin with, we shall expand the labeling system described above. Previously, four labels have been introduced: phase 0, phase 1, phase 2 and junk. Now we add one more phase called tail, and split each phase $j^{\textrm{th}}$ into two subphases: these are the phases $F_{0}$, $F_{1}$, $F_{2}$, and $B_{0}$, $B_{1}$, $B_{2}$, respectively. The sense of these subphases is clear and apparent: they correspond to forward reading ($F_{0}$, $F_{1}$ and $F_{2}$) and backward reading ($B_{0}$, $B_{1}$ and $B_{2}$) of genes, in leader and ladder strands, respectively. The index coincides to the reminder of the division of the distance between the start position of a coding regions, and the center of a fragment, by 3.

The tail phase looks the most intriguing. First of all, it comprises the fragments falling into a dense series of tRNA (5S RNA, 25S RNA, etc.) genes. Probably, the points indicated as junk in the tail phase are the border fragments.

Now consider several genomes shown in principal components in two projection: in “full face” and in “profile”. The former means that the first principal component is normal to the plane of view, and the latter means that the first principal component is in the plane of view.

Figure 1: The distribution of 12 244 fragments of Lolium perenne chloroplast genome (AC AM777385), “profile”, in principle coordinates. Left image presents a general overview, and the right one presents the phases $F_{0}$ – red triangles, $F_{1}$ – bright green diamonds, $F_{2}$ – light blue circles, $B_{0}$ – rosy triangles, $B_{1}$ – sand diamonds, $B_{2}$ – dark blue circles.

Fig. 1 presents the “profile” view of the fragments distribution of ray grass (Lolium perenne, AC AM777385 in EMBL–bank) genome, the coding regions. This is a typical “bullet-like” pattern of the distribution. In the right in this Figure the same distribution is shown with indication of the fragments labeled in color (see Figure legend). Junk phase is shown in the right figure in black.

Thus, eight clusters are distinctively identified, in this Figure: six ones correspond to six phases (from $F_{0}$ to $B_{2}$, respectively), the seventh cluster comprises the junk labeled fragments, and the eighth cluster (that is the tail) comprises the fragments of all seven mentioned above phases, while it is evidently distinguished from a main body of the distribution.

Figure 2: Same genome as in Fig. 1, with junk phase erased; left is “profile” sight, and right is “full face” sight; color labeling is the same as in Fig. 1.

This genome exhibits a typical “four-cluster” pattern, when seen in “full face”: the clusters corresponding to leader and ladder strand coincide, in the this projection mode.

Another very important feature of this genome is the clearly visible tail phase, in the distribution of fragments. This is rather frequent pattern observed among the studied genomes. The difference between the dictionaries $W^{(0)}_{(3,3)}$, $W^{(1)}_{(3,3)}$ and $W^{(2)}_{(3,3)}$ (see Table 1) manifests in the clustering in “wings” (shown in color in Figs. 1 and 2); on the contrary, the lack of such difference observed for junk phase fragments results in a ball-shaped distribution of these points, in 63-dimensional space.

(a) “profile”

(b) “full face”

Figure 3: The same genome as in Fig. 1, junk phase shown in two projections, coding phases are erased.

Fig. 3 shows the junk phase fragments, only, with all the other erased from an image, in two projections. Unlike the bacterial genomes gorban1 ; gorban2 , here junk exhibits the separation into two clusters (see Fig. 3(a)). It should be stressed that such two-cluster pattern of the distribution of the fragments falling into junk areas of a genome may not be observed, in general, without the fragments corresponding to coding areas of the genome. The question whether the junk phase fragments yield a pattern themselves, solely, is still open. Strictly speaking, this split of a junk fragments ensemble into a body of junk in proper sense, and in tail phase forces to claim the eight-cluster structure occurrence in chloroplasts genomes, in contrary to the patterns observed for bacterial genomes gorban1 ; gorban2 .

Let now consider the fragments comprising the tail in more detail. To do that, we determine $\mathsf{GC}$-content both for the entire genome, and for each fragment, and plot then the content against the number of a fragment. Fig. 4 shows this plot; the tail phase is colored in red. Let us remind, that the genome-wide $\mathsf{GC}$-content of this entity is equal to 0.38. The overall $\mathsf{GC}$-content has been reported to be the key factor defining the structure of clustering of the fragments formally identified within a bacterial genome gorban1 ; gorban2 ; that former has significantly less effect, for chloroplast genomes. A tight examination of Table LABEL:genomy shows that $\mathsf{GC}$-content varies from 0.28 (Orthotrichum rogeri, AC KP119739 and Syntrichia ruralis, AC FJ546412) to 0.51 for Selaginella moellendorffii, AC HM173080 and even 0,55 for Selaginella uncinata, AC AB197035. Meanwhile, this Table says nothing about the specific values of $\mathsf{GC}$-content of the fragments identified within various chloroplast genomes. Fig. 5 answer this question.

Figure 4: The plot of $\mathsf{GC}$-content of all the fragments layered out alongside the Lolium perenne chloroplast genome; the tail phase (Fig. 3) is shown in red.

This Figure shows the set of chloroplast genomes under consideration (see Table LABEL:genomy)

	Gene	junk	tail
Genome	0.9745	0.9617	0.6248
Gene		0.9218	0,6285
junk			0.5939

Table 3: Table of correlations

ordered with respect to the genome-wide $\mathsf{GC}$-content value. Besides, this Figure shows the plots of average $\mathsf{GC}$-content determined over the ensemble of coding fragments (all six phases), of average $\mathsf{GC}$-content of non-coding fragments, and of average $\mathsf{GC}$-content of tail phase fragments. Evidently, the plots of genome-wide, coding and non-coding $\mathsf{GC}$-content figures exhibit a high concordance in behaviour, while the tail phase fragments ensemble remains rather permanent.

Table 3 shows the correlations coefficients determined between averaged figures of $\mathsf{GC}$-content of four ensembles of the fragments of genomes. The figures shown in Table 3 reveal the relative independence of the tail phase from the other parts of a genome, and $\mathsf{GC}$-content of that latter never falls beyond 0.50 level. The set of genomes with lower figures of $\mathsf{GC}$-content comprises the species Orthotrichum rogeri, Syntrichia ruralis, Physcomitrella patens, Marchantia polymorpha, Sanionia uncinata, Anthoceros angustus, Ptilidiumpul cherrimum, Equisetum arvense, Glycyrrhiza glabra, Trifolium subterraneum, Orobanche gracilis, Taxus mairei, Millettia pinnata, Pisum sativum, Juniperus virginiana and Juniperus bermudiana. The genomes of Aneura mirabilis, Lygodium japonicum, Pteridium aquilinum, Ophioglossum californicum, Marsilea crenata and Myriopteris lindheimeri comprise the opposite group with higher figure of $\mathsf{GC}$-content. Finally, two species (these are Selaginella moellendorffii and S. uncinata) yield the highest level of $\mathsf{GC}$-content (see Table LABEL:genomy for details).

Figure 5: Average $\mathsf{GC}$-content for entire genome, coding, non-coding parts and tail phase (cumulatively).

Let now focus on the behaviour of the $\mathsf{GC}$-content of the fragments comprising tails in the distribution of the fragments (see Fig. 5). Remarkably, there is no genome with $\mathsf{GC}$-content figure lower than 0.5, for these fragments. Differing in this figure from the entire genome, the tails ensemble still comprises both coding, and non-coding fragments. The former are presented by densely located tRNA genes, 5S RNA and 16S RNA genes. This fact holds true for all genomes exhibiting a tail phase, and such genomes make a majority of entities studied in this paper.

Let now provide some examples of the fragments distributions observed in chloroplast genomes with various $\mathsf{GC}$-content values. Consider the moss Physcomitrella patens (AC AP005672) genome with $\mathsf{GC}$-content equal to 0.29 (next to the lowest one in the list of studied genomes).

Figure 6: The distribution of 11 118 fragments of moss Physcomitrella patens chloroplast genome (AC AP005672), left is “profile”, and right is “full face”: $F_{0}$ – red triangles, $F_{1}$ – bright green diamonds, $F_{2}$ – dark blue circles, $B_{0}$ – rosy triangles, $B_{1}$ – dark green diamonds, $B_{2}$ – blue circles.

This is the model organism often used in evolutionary studies. Fig. 6 shows two projections of the full plot of the fragments; one easily can see similar pattern with two “tripods” overlapping each other, and the tail phase part. It should be stressed, that this genome exhibits another triplet with the least standard deviation figure: $\mathsf{CGC}$, on the contrary to that one shown in Fig. 1. This genome exhibits stronger split of two phases (these are $F_{1}$ vs. $B_{0}$ and $F_{0}$ vs. $B_{1}$), in comparison to the pattern shown in Fig. 2; yet, the congruence of all the phases is strong enough.

To make it more clear, we show the distribution of all the fragments (the color labeling is the same as in Fig. 6) falling in coding regions, only; all the points corresponding to junk phase are erased. This figure allows to see that the third phase in this genome slightly deviates, in its clustering pattern, from two other couples: a reasonable part of blue and dark blue points belong to another cluster than that one comprising the third phase fragments. This distribution is shown in Fig. 10.

Fig. 7 shows the distribution of junk phase fragments of the moss genome. Similar to Fig. 3, this genome also exhibits an occurrence of some points of junk in tail phase. Whether it is a biologically sounding fact, still awaits for an answer. Again, it should be borne in mind, that all the distributions shown in Figs. 6 to 7 are not independent: actually, all these figures just show the same distribution, while some points are not shown in various figures; still, they affect the distribution pattern.

(a) “profile”

(b) “full face”

Figure 7: Junk-phase only distribution of moss chloroplast genome fragments.

The patterns shown in Figs. 1 to 7 present a typical structuredness in a distribution of the small fragments of chloroplast genome. Actually, all the genomes except two entities exhibit such pattern in fragments distribution; these latter are the genomes of Selaginella moellendorffii (AC HM173080) and S. uncinata (AC AB197035). They are extremely ancient and rather isolated mosses belonging to primitive vascular plants. First of all, they have other triplets with the least standard deviation: $\mathsf{GAC}$ and $\mathsf{TAA}$, respectively. Fig. 8 shows the distribution of all phases of S. moellendorffii genome.

(a) “no junk, profile”

(b) “junk, profile”

(c) “no junk, face”

(d) “junk, face”

Figure 8: Selaginella moellendorffii chloroplast genome fragments distribution; upper is profile view, lower is face view.

There is no tail phase at all, in this genome, neither in coding phases, nor in non-coding one. The pattern of distribution for S. uncinata is pretty close to that one shown in Fig. 8. Another indirect evidence for this issue is discussed in cyano_ancest (see also very useful paper sato ).

III.2 Chloroplasts and cyanobacteria

The essential difference in the structuredness of a genome of chloroplast from bacterial genome is the key issue of the work. Still, the question arises whether this difference is essential. In other words, while chloroplasts form a tight and uniform group of genome bearers, bacteria are extremely diverse, both in genetics, phylogeny, taxonomy, physiology and ecology. What if there are some bacteria that had fallen out from our analysis, but still are close to chloroplasts, in the sense of the small fragments distribution? Indeed, the diversity of bacteria is huge, and there is no guarantee of the total absence of the coincidence of the structure described above when retrieved from some bacterial genome.

Speaking on the similitude or any other semblance of the patterns observed in chloroplast genomes to those observed in bacterial genomes, one should first of all concentrate on the comparison of the structures of chloroplasts, and cyanobacteria. These latter are stipulated to be the other branch of descendants of the common ancestor of chloroplasts and modern bacteria. Here we do not study this point in detail, while some preliminary results zhob18 show that the divergence between chloroplasts and cyanobacteria is tremendous. Fig. 9 illustrate the point.

(a) “profile”

(b) “full face”

Figure 9: Nostoc sp. PCC 7107 distribution of fragments, $\Delta=1005$, $R=202$.

IV Discussion

Let now get back to the labeling system (see page junk,) of the formally identified fragments in a sequence. It provides a reasonable balance between the impact of coding and non-coding regions. Since the label value depends on the central nucleotide position, then approximately a half of the “border” fragments (i. e. those that cover the border between coding and non-coding regions in a genome) are labeled as junk, and another half are labeled as coding ones, with the specific phase value. Suppose, the total number of coding regions in a chloroplast genome is 50. Then an approximate number of “border” fragments labeled as junk is estimated as

$$\dfrac{L}{2R}\times 50\times 2\approx 2\,500\,,$$ (5)

where the factor 2 counts both forward and backward oriented coding regions. The same number (5) of the “border” fragments would be labeled with some phase figures; this parity guarantees, to some extent, a lack of distortion in the fragments clustering.

Papers gorban1 ; gorban2 present an approach to figure out a structuredness in bacterial genomes based on systemic and sequential comparison of frequency dictionaries of the fragments of a genome; the fragments were identified in the same way, as we have done. It should be stressed that such fragments were identified with neither respect to a functional charge of a fragment. The results presented in these papers show that the fragments tend to cluster located in the vertices of two triangles. The triangle vertices correspond to the phase of a fragment; in other words, a cluster comprises the fragments that have the same reading frame shift figure. A mutual arrangement of these two triangles is completely determined by the average (over the genome) figure of $\mathsf{GC}$-content, for bacterial genomes.

Figure 10: Junk-free distribution of moss chloroplast genome. Denotations are the same as in Fig. 6.

A general seven-cluster structure was reported, for bacterial genomes, in these papers; the seventh cluster comprises the fragments falling into a junk area of the genome. The papers gorban1 ; gorban2 also provide an elegant explanation of an origin of this seven-cluster structuredness, describing the constraints forcing two triangles to rotate and project one over another. Here the genome-wide $\mathsf{GC}$-content is claimed to be the only key factor determining the pattern of the cluster structure. A minor variation of $\mathsf{GC}$-content results in visible change of the structure pattern.

There are following patterns of the fragments distribution, observed on bacterial genomes, for various figures of $\mathsf{GC}$-content. $\mathsf{GC}$-content close to 25 % yields two “parallel triangles” (for $\mathsf{AT}$-reach genomes); the growth of $\mathsf{GC}$-content to $\sim 35\,\%$ yields the pattern with two “orthogonal triangles”, and the raise of $\mathsf{GC}$-content up to 60 % results in degeneration of two triangles into a single plane. Besides, the authors of gorban1 ; gorban2 claim such seven-cluster pattern be universal one; meanwhile, our results disprove this hypothesis.

IV.1 Cluster structure of chloroplast genomes

Since chloroplasts take their origin from bacteria merezh ; merezh1 ; curopin2014 ; ravenallen , then one may expect they inherit this universal pattern of the inner genome structuredness. Our results disprove this assumption; moreover, $\mathsf{GC}$-content of chloroplast genomes does not impact on the pattern of fragments distribution. The newly found pattern in small fragments distribution in 63-dimensional triplet frequency space seems to be very universal: there are two only exclusions from the list of studied genomes (see Table LABEL:genomy). They are presented by two ancient moss species (Selaginella moellendorffii and Selaginella uncinata) originated more than $4\times 10^{8}$ years ago.

The list of other genomes (see Table LABEL:genomy) is apparently split into two parts: the former has the triplet $\mathsf{GCG}$ exhibiting the least standard deviation level, and the latter has the triplet $\mathsf{CGC}$. Indeed, these triplets exhibit a high similitude. The point is that they comprise so called complementary palindrome. Palindrome itself is a word that read equally in opposite directions (e. g., level in English; two words may form a palindromic couple (god $\Leftrightarrow$ dog in English). The triplets $\mathsf{GCG}$ and $\mathsf{CGC}$ yield the so called complementary palindrome: a couple of two strings of DNA sequence that are read equally in opposite directions with respect to the Chargaff’s substitute rule ($\mathsf{A}\Leftrightarrow\mathsf{T}$ and $\mathsf{C}\Leftrightarrow\mathsf{G}$). This really important symmetry in frequency dictionaries, but it completely falls beyond the scope of this paper.

Another important question here is whether the observed clusters corresponding to six phases (these are $F_{0}$, $F_{1}$, $F_{2}$, $B_{0}$, $B_{1}$ and $B_{2}$) really comprise clusters, or it is a kind of artifact resulted from a visualization technique. This question has obvious and transparent answer: yes, the clusters observed by visualization of the phases are the real clusters identified with a clustering technique. To check it, we have carried out $K$-means cluster implementation, of the frequency dictionaries corresponding to the fragments.

(a) “full face”

(b) inner coordinates

Figure 11: $K$-means ($K=4$) for Physcomitrella patens (AC AP005672) chloroplast genome.

Fig. 11 shows the clustering developed by $K$-means fukunaga (with $K=4$) for the moss genome. Again, we did not aim to figure out some cluster structure due to $K$-means, but to verify the cluster structure observed in genomes through the visualization (that is the phase coloring). The clustering shown in Fig. 11 is very stable: a hundred runs of $K$-means always resulted in the same distribution of points. So, the clusters like those shown in Figs. 1, 2, 6 and 10 are the really existing entities, not an artifact.

Few words should be said towards the pictures shown in Fig. 11. The left picture presents the distribution of all the fragments (of course, converted into frequency dictionaries) in 63-dimensional space, in principal components, the “full face” projection and clustered into four classes by $K$-means. Obviously, the classes identified by $K$-means comprise the points belonging both to some coding phase, and to the non-coding phase; yet, we did not aim to separate the points by $K$-means in the same manner, as by coloring. The right picture shows the same distribution in so called inner coordinates of an elastic map; the details on this techniques could be found in n3_3 ; n4 ; gorbanzyn2 ; gorbanzyn ; gorbanzyn1 ; gorbanzyn3 .

Careful examination of Figs. 1, 2, 6 and 10 shows the general situation in localization of the phases, within a pattern. Indeed, the localization of the phases could be described by the following cyclic diagrams: $F_{0}\rightarrow F_{1}\rightarrow F_{2}\rightarrow F_{0}$ (clockwise), and $B_{0}\rightarrow B_{1}\rightarrow B_{2}\rightarrow B_{0}$ (counterclockwise). In fact, these two diagrams mirror each other, so that no complete coincidence

(a) “up”

(b) “down”

Figure 12: “Up” and “down” orientation of the clusters shown on two genomes: Ranunculus macranthus (up), and Anthoceros angustus (down).

make take place due to rotation. Such mirror symmetry corresponds to the double-stranded structure of DNA; the localization of $F_{2}$ and $B_{2}$ phases in the same projection is here of greater importance. All the studied chloroplast genomes exhibit such mirroring symmetry, while there are no evidences for that latter in bacterial ones gorban1 ; gorban2 . The phases $F_{0}$, $F_{1}$, $F_{2}$ make a triangle with given vertices circuit direction; same is true for the phases $B_{0}$, $B_{1}$ and $B_{2}$, and the circuit direction is the same, as for $F$-phases. This fact seems to be universal for bacteria (and some other genomes, e. g. fungi ones); on the contrary, chloroplast genomes exhibit exactly opposite pattern: they have counter-directed circuit directions, for those phases. Papers assym_pnas ; struktura report on another type of structuredness found in chloroplast genomes, while we believe the mechanism staying behind these structures and those we are showing here, is the same: triplet frequency peculiarities. More specific mechanism based on codon bias yields a structuredness reported in triplsymmetry . These facts may reveal the “independent” evolution of chloroplast genomes (see also comparanal ; chloro_evol2 ), on the contrary to the synchronized evolution of these latter with the host nuclear genome nasha2 . Also, such symmetry may answer the question towards the attribution of contigs for de novo assembling genomes sfu1 ; sfu2 ; sfu3 (see also another sight on the problem in necodir_evol ).

This mirroring has one more manifest in mutual location of the clusters comprising different phases. Fig. 12 illustrates this fact: while the location of phase 0 and phase 1 remains the same, in both subfigures, the location of the phase 2 takes mirroring positions. The phase 2 cluster faces down, for Anthoceros angustus, and that former faces up for large buttercup (Ranunculus macranthus). To make the images more apparent, we have erased the points corresponding to junk. Two positions of phase 2 cluster correspond to two mirroring axes systems. Let now get back to Table LABEL:genomy; the last column in the table (labeled with $\Updownarrow$ sign) indicates the orientation of the clusters: $\mathsf{U}$ stands for “up” positioning of the cluster, and $\mathsf{D}$ stands for “down” positioning of that latter. Comparing Figs. 2, 10, 6, 12 to Fig. 9 (see Subsec. III.2), one sees that such mirroring symmetry is universal, for chloroplast genomes; cyanobacteria that are claimed to be evolutionary related to chloroplasts, do not exhibit such pattern, at all.

Another sounding manifestation of the symmetry is the interchange of the triplet yielding the least standard deviation figure; see again Table LABEL:genomy. Indeed, with exclusion of two triplets (these are $\mathsf{GAC}$ and $\mathsf{TAA}$), all other entries exhibit either $\mathsf{GCG}$, or $\mathsf{CGC}$ triplet yielding the least standard deviation figure. The species with unconventional triplets $\mathsf{GAC}$ and $\mathsf{TAA}$ are actually the ancient moss organisms of Selaginella genus appeared app. 400 billion years ago. The unconventionality of the triplets yielding the least standard deviation figure may result from this long isolated lineage.

	$\mathsf{CGC}$	$\mathsf{GCG}$
$\mathsf{U}$	41	95
$\mathsf{D}$	20	19

Table 4: Distribution of patterns.

Apart these two species, all other ones (see Table LABEL:genomy) could be split into two groups: the former with $\mathsf{GCG}$ triplet yielding the least standard deviation, and the latter with $\mathsf{CGC}$ triplet; the abundances of each groups are 115 and 61 entries, respectively. It should be mentioned that two genomes were not annotated, completely; thus, we were not able to determine what type of symmetry they exhibit. Table 4 summarizes the distribution of chloroplast genomes over the combinations of $\mathsf{U}\leftrightarrow\mathsf{D}$ variants, and the triplets $\mathsf{CGC}\leftrightarrow\mathsf{GCG}$. In such capacity, the genomes with $\mathsf{CGC}$ triplet differ from those with $\mathsf{GCG}$ ones. Whether this difference is of a nature of things, or results from a bias of the database used in the study, should be examined further. One definitely could say there is no correlation between the pattern of orientation, triplet with the least standard deviation figure, and separation of plants on gymnosperm vs. angiosperm species (cf. Table 4 and Table LABEL:genomy).

IV.2 Specific type of symmetry and coding regions

Consider now the abundances of the beams (or clusters) corresponding to the phases $F_{0}$ through $B_{2}$; obviously, the must be equal, or at least pretty close, since the beams differ in the reading frame shift of a triplet, only. Typical figures are the following: $|F_{0}+B_{0}|=2489,4$, $|F_{1}+B_{1}|=2488,6$, and $|F_{2}+B_{2}|=2485,8$. The greatest standard deviation of the beam abundances is provided by Hibiscus syriacus (AC KP688069 in EMBL–bank), and the figure is 14.53. Reciprocally, the least figure (that is exactly zero) is provided by Olimarabidopsis pumila (AC AP009368).

The difference between the phases $|F_{0}-B_{0}|$, $|F_{1}-B_{1}|$ and $|F_{2}-B_{2}|$ are of greater interest. These figures vary from $-1305$ (averaged over three beams), for Ophioglossum californicum (AC KC117178) to 1387, for Equisetum arvense (AC GU191334). Fig. 13 shows the relation of the bias in forward and backward coding regions occurrence, in different organisms, and the type of their mirroring symmetry.

Figure 13: The bias within a phase, and the type of mirroring symmetry; see explanation in text.

This figure shows the set of genomes (Table LABEL:genomy) ordered ascending on $|F_{0}-B_{0}|$ figures; in other words, the left genome has $|F_{0}|-|B_{0}|=-1362$ (that is Ophioglossum californicum, AC KC117178), while the right one exhibits $|F_{0}|-|B_{0}|=1382$ (that is Equisetum arvense, AC GU191334). The solid black line in this Fig. shows the standard deviation of cluster abundances determined over all six phases; small red diamonds show the symmetry orientation: upper dots show $\mathsf{U}$ type, and lower ones show $\mathsf{D}$ type. It seems that the excess of the abundance of the fragments belonging to backward phases over those belonging to forward phases in 600 entities results in the unambiguous determination of $\mathsf{U}$ type symmetry orientation; the right end of this curve supports, to some extent, this idea.

IV.3 What is beyond?

The study of statistical properties of DNA sequences still challenges researchers, and may bring a lot new. Here we have demonstrated basic structural difference of chloroplast genomes from the bacterial ones, manifested in the clustering in distribution of small formally identified fragments of a genome. Below are some issues that had fallen from the scope of this paper, while they are rather important to be considered in the nearest future.

IV.3.1 Dark matter of a genome

Functional and evolution roles of the junk in a genome still is conspired from researchers. It is extremely doubtful that junk has no matter in a genome, neither it plays no role in various and complicated biological processes involved into an inherited information processing and functioning. For some cases (see sfu1 ; sfu2 ; sfu3 , the removal of junk enforces the clustering of coding regions and makes easier the comprehension of the peculiarities standing behind. Yet, special efforts must be addressed to reveal the role and impact of junk regions of a genome on the processes mentioned above.

A variety of aspect of the influence of a junk on clustering observed within a genome is very wide. Not speaking about the differences in statistical properties of frequency dictionaries $W_{(3,3)}$ (and $W_{(m,n)}$, in general) observed for junk fragments of a genome vs. those observed for coding ones, one may expect even the strong impact from the ratio of coding/non-coding parts occurred within a genome. For instance, here we report on mirror symmetry in mutual interlocation of six coding phases, for the frequency dictionary $W_{(3,3)}$ developed for chloroplast genomes. Fig. 9 explicitly demonstrates an absence of such symmetry, for cyanobacteria genome, and this fact may result from a significant difference in the coding/non-coding ratio figures observed for these genetic systems.

IV.3.2 Other chloroplast genomes

Here we present some results obtained on the careful examination of 178 genomes of ground plants. Yet, the generality of the observation awaits for further approval: first of all, one should study the chloroplast genomes of the organisms deviating rather far from the studied ones, in ecology (water plants, and algae, especially), physiology, taxonomy. Such systemic examination is the matter of the nearest future work of ours.

V Conclusion

Here we studied the structuredness of chloroplast genomes revealed trough the clustering of frequency dictionaries of considerably short fragments of a genome that were determined formally, with neither respect to the function encoded in a part of the genome fell into the fragment. The triplet dictionaries were developed, to cluster; these former counts triplets with no overlapping, while with no gaps between any two triplets. The fragments are distributed into eight distinct clusters: six of them gather the fragments falling into the coding regions, and differ in reading frame shift; the shift manifests in phase index of a fragment. The seventh cluster comprises the fragments falling into non-coding regions, and finally, he eighth cluster (so called tail) comprises the fragments with excessive $\mathsf{GC}$-content value. These fragments correspond to the region where various tRNA and S RNA genes are concentrated; probably, this cluster includes also the “border” fragments (those that contain a border between coding and non-coding parts of a genome).

The clusters exhibit wonderful mirroring symmetry: the phase circuit in the forward and backward strands are counter-directed; this fact completely contradicts to the similar structure observed for bacteria, including cyanobacteria (which are stipulated to be the descendants of a common ancestor with chloroplasts). Such mirror symmetry yields a separation of the genomes into two groups: those with “up”-directed location of the cluster comprising $F_{2}$ and $B_{2}$ phases vs. those with “down”-directed; apparently, the threshold in the abundances of the phases gathered into a single cluster determines the direction of the $F_{2}\div B_{2}$ cluster.